.. _docs-config:

Configuration
-------------

Two configuration files, in easy to write `YAML format`_, specify
details about your system and samples to run:


- ``bcbio_sample.yaml`` Details about a set of samples to process,
  including input files and analysis options. You configure these for
  each set of samples to process. This will be the main file prepared for each
  sample run and the documentation below details techniques to
  help prepare them.

- ``bcbio_system.yaml`` High level information about the system, including
  locations of installed programs like GATK and cores and memory usage (see
  :ref:`tuning-cores`). These apply across multiple runs. The automated
  installer creates a ready to go system configuration file that can be manually
  edited to match the system. Find the file in the galaxy sub-directory within
  your installation data location (ie.
  ``/usr/local/share/bcbio-nextgen/galaxy``). To modify system parameters for a
  specific run, supply :ref:`sample-resources` in your ``bcbio_sample.yaml`` file.

Commented `system`_ and `sample`_ example files are available in the
``config`` directory. The :ref:`example-pipelines` section contains
additional examples of ready to run sample files.

.. _automated-sample-config:

Automated sample configuration
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~

bcbio-nextgen provides a utility to create configuration files for
multiple sample inputs using a base template. Start with one of
the `best-practice templates`_, or define your own, then apply to
multiple samples using the template workflow command::

    bcbio_nextgen.py -w template freebayes-variant project1.csv sample1.bam sample2_1.fq sample2_2.fq

- ``freebayes-variant`` is the name of the standard ``freebayes-variant.yaml``
  input, which the script fetches from GitHub. This argument can also
  be a path to a locally customized YAML configuration. In both cases,
  the script replicates the single sample template configuration to
  all input samples.

- ``project1.csv`` is a comma separated value file containing sample
  metadata, descriptions and algorithm tweaks::

        samplename,description,batch,phenotype,sex,variant_regions
        sample1,ERR256785,batch1,normal,female,/path/to/regions.bed
        sample2,ERR256786,batch1,tumor,,/path/to/regions.bed

  The first column links the metadata to a specific input file. The
  template command tries to identify the ``samplename`` from read group
  information in a BAM file, or uses the base filename if no read group
  information is present. For BAM files, this would be the filename without the
  extension and path (``/path/to/yourfile.bam => yourfile``). For FASTQ
  files, the template functionality will identify pairs using standard
  conventions (``_1`` and ``_2``, including Illumina extensions like ``_R1``),
  so use the base filename without these (``/path/to/yourfile_R1.fastq => yourfile``).
  Note that paired-end samples sequentially numbered without leading zeros
  (e.g., ``sample_1_1.fastq``, ``sample_1_2.fastq``, ``sample_2_1.fastq``, ``sample_2_2.fastq``,
  etc., will likely not be parsed correctly; see `#1919 <https://github.com/bcbio/bcbio-nextgen/issues/1919>`_ for more info). In addition, ``.`` characters could be problematic,
  so it's better to avoid this character and use it only as separation
  for the file extension.

  For :ref:`docs-cwl` inputs, the first ``samplename`` column should contain
  the base filename. For BAM files, this is ``your_file.bam``. For fastqs
  this is ``your_file_R1.fastq.gz;your_file_R2.fastq.gz``, separating individual
  files with a semicolon. By putting paths to the actual locations of the inputs
  in your ``bcbio_system.yaml`` input when generating CWL, you can easily move
  projects between different filesystems.

    The remaining columns can contain:

   - ``description`` Changes the sample description, originally
     supplied by the file name or BAM read group, to this value. You can also
     set the ``lane``, although this is less often done as the default
     sequential numbering works here. See the documentation for
     :ref:`sample-configuration` on how these map to BAM read groups.

   - Algorithm parameters specific for this sample. If the column name matches
     an available :ref:`algorithm-config`, then this value substitutes
     into the sample ``algorithm``, replacing the defaults from the template.
     You can also change other information in the BAM read group through the
     ``algorithm`` parameters. See :ref:`alignment-config` configuration
     documentation for details on how these map to read group information.

   -  :ref:`sample-configuration` metadata key/value pairs. Any columns not
      falling into the above cases will go into the metadata section. A ``ped``
      specification will allow bcbio to read family, gender and phenotype
      information from a PED input file and use it for batch, sex and phenotype,
      respectively. The PED inputs supplement information from the standard
      template file, so if you specify a value in the template CSV the PED
      information will no overwrite it. Alternatively, ``ped`` fields can
      be specified directly in the metadata as columns. If ``family_id`` is
      specified it will be used as the ``family_id`` for that sample, otherwise
      ``batch`` will be used. The ``description`` column is used as the
      ``individual_id`` column and the ``phenotype`` column will be used for as
      the ``affected`` column in the PED format::

       samplename,description,phenotype,batch,sex,ethnicity,maternal_id,paternal_id,family_id
       NA12878.bam,NA12878,-9,CEPH,female,-9,NA12892,NA12891,NA12878FAM

  Individual column items can contain booleans (true or false), integers, or
  lists (separated by semi-colons). These get converted into the expected time
  in the output YAML file. For instance, to specify a sample that should go into
  multiple batches::

       samplename,description,phenotype,batch
       normal.bam,two_normal,normal,Batch1;Batch2

  For dictionary inputs like :ref:`somatic-w-germline-variants` setups, you can
  separate items in a dictionary with colons and double colons, and also use
  semicolons for lists::

       samplename,description,phenotype,variantcaller
       tumor.bam,sample1,tumor,germline:freebayes;gatk-haplotype::somatic:vardict;freebayes

  The name of the metadata file, minus the ``.csv`` extension, is a
  short name identifying the current project. The script creates a
  ``project1`` directory containing the sample configuration in
  ``project1/config/project1.yaml``.

- The remaining arguments are input BAM or FASTQ files. The script
  pairs FASTQ files (identified by ``_1`` and ``_2``) and extracts
  sample names from input BAMs, populating the ``files`` and
  ``description`` field in the final configuration file. Specify the
  full path to sample files on your current machine.

To make it easier to define your own project specific template, an
optional first step is to download and edit a local template. First
retrieve a standard template::

    bcbio_nextgen.py -w template freebayes-variant project1

This pulls the current GATK best practice variant calling template
into your project directory in
``project1/config/project1-template.yaml``. Manually edit this file to
define your options, then run the full template creation for your
samples, pointing to this custom configuration file::


    bcbio_nextgen.py -w template project1/config/project1-template.yaml project1.csv folder/*

If your sample folder contains additional BAM or FASTQ files you do not wish to
include in the sample YAML configuration, you can restrict the output to only
include samples in the metadata CSV with ``--only-metadata``. The output will
print warnings about samples not present in the metadata file, then leave these
out of the final output YAML::

    bcbio_nextgen.py -w template --only-metadata project1/config/project1-template.yaml project1.csv folder/*


.. _best-practice templates: https://github.com/bcbio/bcbio-nextgen/tree/master/config/templates

.. _multi-files-sample-configuration:

Multiple files per sample
~~~~~~~~~~~~~~~~~~~~~~~~~

In case you have multiple FASTQ or BAM files for each sample you can use ``bcbio_prepare_samples.py``.
The main parameters are:

- ``--out``: the folder where the merged files will be
- ``--csv``: the CSV file that is exactly the same as described previously, but having as many duplicate lines for each sample as files to be merged::


        samplename,description,batch,phenotype,sex,variant_regions
        file1.fastq,sample1,batch1,normal,female,/path/to/regions.bed
        file2.fastq,sample1,batch1,normal,female,/path/to/regions.bed
        file1.fastq,sample2,batch1,tumor,,/path/to/regions.bed

An example of usage is::


    bcbio_prepare_samples.py --out merged --csv project1.csv

The script will create the ``sample1.fastq,sample2.fastq`` in the ``merged`` folder, and a new CSV file
in the same folder than the input CSV :``project1-merged.csv``. Later, it can be used for bcbio::


    bcbio_nextgen.py -w template project1/config/project1-template.yaml project1-merged.csv merged/*fastq

The new CSV file will look like::

        samplename,description,batch,phenotype,sex,variant_regions
        sample1.fastq,sample1,batch1,normal,female,/path/to/regions.bed
        sample2.fastq,sample2,batch1,tumor,,/path/to/regions.bed

It supports parallelization the same way ``bcbio_nextgen.py`` does::


    python $BCBIO_PATH/scripts/utils/bcbio_prepare_samples.py --out merged --csv project1.csv -t ipython -q queue_name -s lsf -n 1

See more examples at `parallelize pipeline`_.

.. _parallelize pipeline: https://bcbio-nextgen.readthedocs.org/en/latest/contents/parallel.html

In case of paired reads, the CSV file should contain all files::

        samplename,description,batch,phenotype,sex,variant_regions
        file1_R1.fastq,sample1,batch1,normal,female,/path/to/regions.bed
        file2_R1.fastq,sample1,batch1,normal,female,/path/to/regions.bed
        file1_R2.fastq,sample1,batch1,normal,femela,/path/to/regions.bed
        file2_R2.fastq,sample1,batch1,normal,female,/path/to/regions.bed

The script will try to guess the paired files the same way that ``bcbio_nextgen.py -w template`` does. It would detect paired files if the difference among two files is only
``_R1/_R2`` or ``-1/-2`` or ``_1/_2`` or ``.1/.2``

The output CSV will look like and is compatible with bcbio::

        samplename,description,batch,phenotype,sex,variant_regions
        sample1,sample1,batch1,normal,female,/path/to/regions.bed


.. _sample-configuration:

Samples from GEO or SRA
~~~~~~~~~~~~~~~~~~~~~~~

In case you want to download samples from GEO or SRA repositories, you can use
``bcbio_prepare_samples.py`` as well.

You need to create your project.csv file like this:

        samplename,description
        GSMNNNNN,sample1
        GSMNNNNN,sample2
        SRRNNNNN,sample3


The script will download all the files related to each sample and merge them
in case of multiple files.

Sample information
~~~~~~~~~~~~~~~~~~

The sample configuration file defines ``details`` of each sample to process::

    details:
      - analysis: variant2
        lane: 1
        description: Example1
        files: [in_pair_1.fq, in_pair_2.fq]
        genome_build: hg19
        algorithm:
          platform: illumina
        metadata:
          batch: Batch1
          sex: female
          platform_unit: flowcell-barcode.lane
          library: library_type


- ``analysis`` Analysis method to use [variant2, RNA-seq, smallRNA-seq]

- ``lane`` A unique number within the project. Corresponds to the
  ``ID`` parameter in the BAM read group.

- ``description`` Unique name for this sample, corresponding to the
  ``SM`` parameter in the BAM read group. Required.

- ``files`` A list of files to process. This currently supports either a single
  end or two paired-end FASTQ files, or a single BAM file. It does not yet
  handle merging BAM files or more complicated inputs.

- ``genome_build`` Genome build to align to, which references a genome
  keyword in Galaxy to find location build files.

- ``algorithm`` Parameters to configure algorithm inputs. Options
  described in more detail below:

  - ``platform`` Sequencing platform used. Corresponds to the ``PL``
    parameter in BAM read groups. Optional, defaults to ``illumina``.

- ``metadata`` Additional descriptive metadata about the sample:

   - ``batch`` defines a group that the sample falls in. We perform
     multi-sample variant calling on all samples with the same batch
     name. This can also be a list, allowing specification of a single normal
     sample to pair with multiple tumor samples in paired cancer variant
     calling (``batch: [MatchWithTumor1, MatchWithTumor2]``).

   - ``sex`` specifies the sample gender used to correctly prepare X/Y
     chromosomes. Use ``male`` and ``female`` or PED style inputs (1=male, 2=female).

   -  ``phenotype`` stratifies cancer samples into ``tumor`` and ``normal`` or
      case/controls into ``affected`` and ``unaffected``. Also accepts PED style
      specifications (1=unaffected, 2=affected). CNVkit uses case/control
      status to determine how to set background samples for CNV calling.

   - ``disease`` identifies a specific disease name for the sample. Used along
     with ``svprioritize`` to help identify gene regions for reporting during
     analysis with heterogeneity callers like PureCN and TitanCNA. This is
     primarily for cancer studies and you can narrow genes by disease using
     inputs like `lung`, `breast` or `pancreatic` for different cancer types.

   - ``prep_method`` A free text description of the method used in sample
     prep. Used to group together samples during CNV calling for background.
     This is not required and when not present bcbio assumes all samples in
     an analysis use the same method.

   - ``svclass`` defines a classification for a sample for use in SV
     case/control setups. When set as ``control`` will put samples into the
     background samples used for normalization.

   - ``ped`` provides a `PED phenotype file
     <http://pngu.mgh.harvard.edu/~purcell/plink/data.shtml#ped>`_
     containing sample phenotype and family information. Template creation uses
     this to supplement ``batch``, ``sex`` and ``phenotype`` information
     provided in the template CSV. GEMINI database creation uses the PED file as input.

   - ``platform_unit`` -- Unique identifier for sample. Optional, defaults to
     ``lane`` if not specified.

   - ``library`` -- Name of library preparation used. Optional, empty if not
     present.

   - ``validate_batch`` -- Specify a batch name to group samples together for
     preparing validation plots. This is useful if you want to process samples
     in specific batches, but include multiple batches into the same
     validation plot.

   - ``validate_combine`` -- Specify a batch name to combine multiple samples
     into an additional validation summary. Useful for larger numbers of small
     samples to evaluate together.

.. _upload-configuration:

Upload
~~~~~~

The ``upload`` section of the sample configuration file describes where to put
the final output files of the pipeline. At its simplest, you can configure
bcbio-nextgen to upload results to a local directory, for example a folder
shared amongst collaborators or a Dropbox account. You can also configure
it to upload results automatically to a Galaxy instance, to
`Amazon S3`_ or to iRODS. Here is the simplest configuration, uploading to a local
directory::

     upload:
       dir: /local/filesystem/directory

General parameters, always required:

- ``method`` Upload method to employ. Defaults to local filesystem.
  [filesystem, galaxy, s3, irods]
- ``dir`` Local filesystem directory to copy to.

Galaxy parameters:

- ``galaxy_url`` URL of the Galaxy instance to upload to. Upload
  assumes you are able to access a shared directory also present on
  the Galaxy machine.
- ``galaxy_api_key`` User API key to access Galaxy: see the
  `Galaxy API`_ documentation.
- ``galaxy_library`` Name of the Galaxy Data Library to upload to. You
  can specify this globally for a project in ``upload`` or for
  individual samples in the sample details section.
- ``galaxy_role`` Specific Galaxy access roles to assign to the
  uploaded datasets. This is optional and will default to the access
  of the parent data library if not supplied. You can specify this
  globally for a project in ``upload`` or for individual samples in
  the sample details section. The `Galaxy Admin`_ documentation
  has more details about roles.

Here is an example configuration for uploading to a Galaxy instance. This
assumes you have a shared mounted filesystem that your Galaxy instance can
also access::

      upload:
        method: galaxy
        dir: /path/to/shared/galaxy/filesystem/folder
        galaxy_url: http://url-to-galaxy-instance
        galaxy_api_key: YOURAPIKEY
        galaxy_library: data_library_to_upload_to

Your Galaxy universe_wsgi.ini configuration needs to have
``allow_library_path_paste = True`` set to enable uploads.

S3 parameters:

- ``bucket`` AWS bucket to direct output.
- ``folder`` A folder path within the AWS bucket to prefix the output.
- ``region`` AWS region name to use. Defaults to us-east-1
- ``reduced_redundancy`` Flag to determine if we should store S3 data
  with reduced redundancy: cheaper but less reliable [false, true]

For S3 access credentials, set the standard environmental variables,
``AWS_ACCESS_KEY_ID``, ``AWS_SECRET_ACCESS_KEY``, and ``AWS_DEFAULT_REGION``
or use `IAM access roles <http://docs.aws.amazon.com/AWSEC2/latest/UserGuide/iam-roles-for-amazon-ec2.html>`_
with an instance profile on EC2 to give your instances permission to create
temporary S3 access.

iRODS parameters:

- ``folder`` Full directory name within iRODS to prefix the output.
- ``resource`` (optional) iRODS resource name, if other than default.

example configuration

      upload:
        method: irods
        dir: ../final
        folder: /irodsZone/your/path/
        resource: yourResourceName

Uploads to iRODS depend on a valid installation of the iCommands CLI, and a preconfigured connection
through the `iinit` command.

Globals
~~~~~~~
You can define files used multiple times in the ``algorithm`` section of your
configuration in a top level ``globals`` dictionary. This saves copying and
pasting across the configuration and makes it easier to manually adjust the
configuration if inputs change::

  globals:
    my_custom_locations: /path/to/file.bed
  details:
    - description: sample1
      algorithm:
        variant_regions: my_custom_locations
    - description: sample2
      algorithm:
        variant_regions: my_custom_locations

.. _algorithm-config:

Algorithm parameters
~~~~~~~~~~~~~~~~~~~~

The YAML configuration file provides a number of hooks to customize
analysis in the sample configuration file. Place these under the
``algorithm`` keyword.

.. _alignment-config:

Alignment
=========

- ``platform`` Sequencing platform used. Corresponds to the ``PL``
  parameter in BAM read groups. Default 'Illumina'.
-  ``aligner`` Aligner to use: [bwa, bowtie, bowtie2, hisat2, minimap2, novoalign, snap,
   star, tophat2, false] To use pre-aligned BAM files as inputs to the pipeline,
   set to ``false``, which will also skip duplicate marking by default.
   Using pre-aligned inputs requires proper assignment of BAM read
   groups and sorting. The ``bam_clean`` argument can often resolve issues with
   problematic input BAMs.
-  ``bam_clean`` Clean an input BAM when skipping alignment step. This
   handles adding read groups, sorting to a reference genome and
   filtering problem records that cause problems with GATK. Options:

     - ``remove_extracontigs`` -- Remove non-standard chromosomes (for human,
       anything that is not chr1-22,X,Y) from the BAM file. This allows
       compatibility when the BAM reference genome has different contigs from
       the reference file but consistent ordering for standard chromosomes.
       Also fixes the read groups in the BAM file as in ``fixrg``. This is
       faster than the full ``picard`` cleaning option.
     - ``fixrg`` -- only adjust read groups, assuming everything else in BAM
       file is compatible.
     - ``picard`` -- Picard/GATK based cleaning. Includes read group changes,
       fixing of problematic reads and re-ordering chromosome order to match the
       reference genome. To fix misencoded input BAMs with non-standard scores,
       set ``quality_format`` to ``illumina``.
-  ``bam_sort`` Allow sorting of input BAMs when skipping alignment
   step (``aligner`` set to false). Options are coordinate or
   queryname. For additional processing through standard pipelines
   requires coordinate sorted inputs. The default is to not do
   additional sorting and assume pre-sorted BAMs.
- ``disambiguate`` For mixed or explant samples, provide a list of
  ``genome_build`` identifiers to check and remove from alignment. Currently
  supports cleaning a single organism. For example, with ``genome_build: hg19``
  and ``disambiguate: [mm10]``, it will align to hg19 and mm10, run
  disambiguation and discard reads confidently aligned to mm10 and not hg19. Affects
  fusion detection when ``star`` is chosen as the aligner. Aligner must be
  set to a non false value for this to run.
- ``align_split_size``: Increase parallelization of alignment. As of 0.9.8,
  bcbio will try to determine a useful parameter and you don't need to set this.
  If you manually set it, bcbio will respect your specification. Set to false
  to avoid splitting entirely. If set, this defines the number of records to
  feed into each independent parallel step (for example, 5000000 = 5 million
  reads per chunk). It converts the original inputs into bgzip grabix indexed
  FASTQ files, and then retrieves chunks for parallel alignment. Following
  alignment, it combines all chunks back into the final merged alignment file.
  This allows parallelization at the cost of additional work of preparing inputs
  and combining split outputs. The tradeoff makes sense when you have large
  files and lots of distributed compute. When you have fewer large multicore
  machines this parameter may not help speed up processing.
-  ``quality_format`` Quality format of FASTQ or BAM inputs [standard, illumina]
-  ``strandedness`` For RNA-seq libraries, if your library is strand
   specific, set the appropriate flag from [unstranded, firststrand, secondstrand].
   Defaults to unstranded. For dUTP marked libraries, firststrand is correct; for
   Scriptseq prepared libraries, secondstrand is correct.
- ``save_diskspace`` Remove align prepped bgzip and split BAM files after
  merging into final BAMs. Helps reduce space on limited filesystems during a
  run. ``tools_off: [upload_alignment]`` may also be useful in conjunction with
  this. [false, true]

Read trimming
=============

- ``trim_reads`` Trims low quality or adapter sequences or at the ends of reads
  using atropos. ``adapters`` and ``custom_trim`` specify the sequences to trim.
  For RNA-seq, it's recommended to leave as False unless running Tophat2.
  For variant calling, we recommend trimming only in special cases where
  standard soft-clipping does not resolve false positive problems. Supports
  trimming with `<https://github.com/jdidion/atropos> atropos`_ or `fastp
  <https://github.com/OpenGene/fastp>`_. ``fastp`` is currently not compatible
  with alignment splitting in variant calling and requires ``align_split_size:
  false``. The old parameter ``read_through`` defaults to using atropos trimming.
  [False, atropos, fastp]. Default to False,
-  ``adapters`` If trimming adapter read through, trim a set of stock
   adapter sequences. Allows specification of multiple items in a list,
   for example [truseq, polya] will trim both TruSeq adapter sequences
   and polyA tails. polyg trimming removes high quality G stretches present in
   NovaSeq and NextSeq data. In the small RNA pipeline, bcbio will try to detect
   the adapter using DNApi. If you set up this parameter, then bcbio will use this value instead.
   Choices: [truseq, illumina, nextera, polya, polyx, polyg, nextera2, truseq2].

   - nextera2: Illumina NEXTera DNA prep kit from NEB
   - truseq2: SMARTer Universal Low Input RNA Kit

-  ``custom_trim`` A list of sequences to trim from the end of reads,
   for example: [AAAATTTT, GGGGCCCC]
- ``min_read_length`` Minimum read length to maintain when
  ``read_through`` trimming set in ``trim_reads``. Defaults to 25.
- ``trim_ends`` Specify values for trimming at ends of reads, using a fast
  approach built into fastq preparation. This does not do quality or adapter
  trimming but will quickly cut off a defined set of values from either the
  5' or 3' end of the first and second reads. Expects a list of 4 values:
  [5' trim read1, 3' trim read1, 5' trim read2, 3' trim read2]. Set values
  to 0 if you don't need trimming (ie. ``[6, 0, 12, 0]`` will trim 6bp from
  the start of read 1 and 12bp from the start of read 2. Only implemented for
  variant calling pipelines.

Alignment postprocessing
========================

-  ``mark_duplicates`` Mark duplicated reads [true, false].
   If true, will perform streaming duplicate marking with
   `biobambam's bammarkduplicates or bamsormadup
   <https://github.com/gt1/biobambam>`_.
   Uses `samblaster <https://github.com/GregoryFaust/samblaster>`_ as an
   alternative if you have paired reads and specifying ``lumpy`` as an
   ``svcaller``. Defaults to true for variant calling and false for RNA-seq and
   small RNA analyses. Also defaults to false if you're not doing alignment
   (``aligner: false``).
-  ``recalibrate`` Perform base quality score recalibration on the
   aligned BAM file, adjusting quality scores to reflect alignments and known
   variants. Supports both GATK and Sentieon recalibration.
   Defaults to false, no recalibration. [false, gatk, sentieon]
-  ``realign`` Perform GATK's realignment around indels on the aligned BAM
   file. Defaults to no realignment since realigning callers like FreeBayes and
   GATK HaplotypeCaller handle this as part of the calling process. [false, gatk]

Coverage information
====================

- ``coverage_interval`` Regions covered by sequencing. bcbio calculates this
  automatically from alignment coverage information, so you only need to
  specify it in the input configuration if you have specific needs or bcbio
  does not determine coverage correctly. ``genome`` specifies full genome
  sequencing, ``regional`` identifies partial-genome pull down sequencing like
  exome analyses, and ``amplicon`` is partial-genome sequencing from
  PCR amplicon sequencing. This influences GATK options for filtering: we use
  Variant Quality Score Recalibration when set to ``genome``, otherwise we
  apply cutoff-based soft filters. Also affects copy number calling with CNVkit, structural
  variant calling and deep panel calling in cancer samples, where we tune
  regional/amplicon analyses to maximize sensitivity.
  [genome, regional, amplicon]
- ``maxcov_downsample`` bcbio downsamples whole genome runs with >10x average
  coverage to a maximum coverage, avoiding slow runtimes in collapsed repeats
  and poly-A/T/G/C regions. This parameter specified the multiplier of average
  coverage to downsample at. For example, `200` downsamples at 6000x
  coverage for a 30x whole genome. Set to `false` or `0` to disable
  downsampling. Current defaults to `false` pending runtime improvements.
-  ``coverage_depth_min`` Minimum depth of coverage. When calculating regions to
   call in, bcbio may exclude regions with less than this many reads. It is not
   a hard filter for variant calling, but rather a guideline for determining
   callable regions. It's primarily useful when trying to call on very low depth
   samples. Defaults to 4. Setting lower than 4 will trigger
   low-depth calling options for GATK.

.. _analysis_regions-config:

Analysis regions
================

These BED files define the regions of the genome to analyze and report on.
``variant_regions`` adjusts regions for small variant (SNP and indel) calling.
``sv_regions`` defines regions for structural variant calling if different than
``variant_regions``. For coverage-based quality control metrics, we first use
``coverage`` if specified, then ``sv_regions`` if specified, then
``variant_regions``. See the section on :ref:`input-file-preparation` for tips
on ensuring chromosome naming in these files match your reference genome. bcbio
pre-installs some standard BED files for human analyses. Reference these using
the naming schemes described in the
`reference data repository <https://github.com/AstraZeneca-NGS/reference_data#capture-region-bed-files>`_.

-  ``variant_regions`` BED file of regions to call variants in.
- ``sv_regions`` -- A specification of regions to target during structural
  variant calling. By default, bcbio uses regions specified in
  ``variant_regions`` but this allows custom specification for structural
  variant calling. This can be a pointer to a BED file or special inputs:
  ``exons`` for only exon regions, ``transcripts`` for transcript regions (the
  min start and max end of exons) or ``transcriptsXXXX`` for transcripts plus a
  window of XXXX size around it. The size can be an integer (``transcripts1000``)
  or exponential (``transcripts1e5``). This applies to CNVkit and heterogeneity
  analysis.
- ``coverage`` A BED file of regions to check for coverage and completeness in
  QC reporting. This can also be a shorthand for a BED file installed by bcbio
  (see :ref:`sv-config` for options).
- ``exclude_regions`` List of regions to remove as part of analysis. This allows
  avoidance of slow and potentially misleading regions. This is a list of the
  following options:

    - ``polyx`` Avoid calling variants in regions of single nucleotide stretches
      greater than 50. These can contribute to long variant calling runtimes
      when errors in polyX stretches align in high depth to these regions and
      take a lot of work to resolve. Since we don't expect decent resolution
      through these types of repeats, this helps avoid extra calculations for
      assessing the noise. This is an alternative to trimming polyX from the 3'
      ends for reads with ``trim_reads`` and ``adapters``. Requires an organism
      with a defined ``polyx`` file in genome resources. For structural variant
      calling, adding ``polyx`` avoids calling small indels for Manta, where
      these can contribute to long runtimes.
    - ``lcr`` Avoid calling variants in low complexity regions (LCRs).
      `Heng Li's variant artifacts paper`_ provides
      these regions, which cover ~2% of the genome but contribute to a large
      fraction of problematic calls due to the difficulty of resolving variants
      in repetitive regions. Removal can help facilitate comparisons between
      methods and reduce false positives if you don't need calls in LCRs for your
      biological analysis. Requires an organism with a defined ``lcr`` file in
      genome resources.
    - ``highdepth`` Remove high depth regions during variant calling, identified
      by collapsed repeats around centromeres in hg19 and GRCh37 as
      characterized in the `ENCODE blacklist <http://hgdownload-test.cse.ucsc.edu/goldenPath/hg19/encodeDCC/wgEncodeMapability/>`_.
      This is on by default for VarDict and FreeBayes whole genome calling to
      help with slow runtimes in these regions, and also on for whole genome
      structural variant calling to avoid false positives from high depth
      repeats.
    - ``altcontigs`` Skip calling in unplaced contigs (Un), limit analysis to standard chromosomes -- 
      chr1-22,X,Y,MT for human -- to avoid slowdowns on the additional contigs. By default bcbio calls variants in 
      unplaced but not in alternative contigs (alleles). Alt contig calling is currently not supported.
.. _variant-config:

Variant calling
===============

-  ``variantcaller`` Variant calling algorithm. Can be a list of
   multiple options or false to skip [false, freebayes, gatk-haplotype,
   haplotyper, platypus, mutect, mutect2, scalpel, tnhaplotyper, tnscope,
   vardict, varscan, samtools, gatk]

    - Paired (typically somatic, tumor-normal) variant calling is currently
      supported by vardict, freebayes, mutect2, mutect (see disclaimer below),
      scalpel (indels only), tnhaplotyper (Sentieon), tnscope (Sentieon) and
      varscan. See the pipeline documentation on
      :ref:`cancer-calling` for details on pairing tumor and normal samples.
    - You can generate both somatic and germline calls for paired tumor-normal
      samples using different sets of callers. The pipeline documentation on
      calling :ref:`somatic-w-germline-variants` details how to do this.
    - mutect, a SNP-only caller, can be combined with indels from scalpel or
      sid. Mutect operates in both tumor-normal and tumor-only modes.
      In tumor-only mode the indels from scalpel will reflect all indels in the sample,
      as there is currently no way of separating the germline from somatic indels in
      tumor-only mode.
- ``indelcaller`` For the MuTect SNP only variant caller it is possible to add
   calls from an indelcaller such as scalpel, pindel and somatic indel detector
   (for Appistry MuTect users only). Currently an experimental option that adds
   these indel calls to MuTect's SNP-only output. Only one caller supported.
   Omit to ignore. [scalpel, pindel, sid, false]
-  ``jointcaller`` Joint calling algorithm, combining variants called with the
   specified ``variantcaller``. Can be a list of multiple options but needs to
   match with appropriate ``variantcaller``. Joint calling is only needed for
   larger input sample sizes (>100 samples), otherwise use standard pooled :ref:`population-calling`:

     - ``gatk-haplotype-joint`` `GATK incremental joint discovery
       <http://www.broadinstitute.org/gatk/guide/article?id=3893>`_ with
       HaplotypeCaller. Takes individual gVCFs called by ``gatk-haploype`` and
       perform combined genotyping.
     - ``freebayes-joint`` Combine freebayes calls using
       `bcbio.variation.recall`_ with recalling at
       all positions found in each individual sample. Requires ``freebayes``
       variant calling.
     - ``platypus-joint`` Combine platypus calls using bcbio.variation.recall
       with squaring off at all positions found in each individual
       sample. Requires ``platypus`` variant calling.
     - ``samtools-joint`` Combine samtools calls using bcbio.variation.recall
       with squaring off at all positions found in each individual
       sample. Requires ``samtools`` variant calling.
- ``joint_group_size`` Specify the maximum number of gVCF samples to feed into
  joint calling. Currently applies to GATK HaplotypeCaller joint calling and
  defaults to the GATK recommendation of 200. Larger numbers of samples will
  first get combined prior to genotyping.
-  ``ploidy`` Ploidy of called reads. Defaults to 2 (diploid). You can also
   tweak specialty ploidy like mitochondrial calling by setting ploidy as a
   dictionary. The defaults are::

        ploidy:
          default: 2
          mitochondrial: 1
          female: 2
          male: 1

- ``background`` Provide pre-calculated files to use as backgrounds for
  different processes. Organized as a dictionary with individual keys for
  different components of the pipeline. You can enter as many or few as needed:

     - ``variant`` A VCF file with variants to use as a background
       reference during variant calling. For tumor/normal paired calling use this to
       supply a panel of normal individuals.
     - ``cnv_reference`` Background reference file for copy number calling. This
       can be either a single file for one CNV method or a dictionary for
       multiple methods. Supports `CNVkit cnn inputs
       <http://cnvkit.readthedocs.io/en/stable/fileformats.html#copy-number-reference-profile-cnn>`_,
       'GATK4 HDF5 panel of normals <https://software.broadinstitute.org/gatk/documentation/article?id=11682>`_
       and `seq2c <https://github.com/AstraZeneca-NGS/Seq2C>`_ combined mapping
       plus coverage files::

           background:
             cnv_reference:
               cnvkit: /path/to/background.cnn
               gatk-cnv: /path/to/background_pon.hdf5
               seq2c: /path/to/background.tsv

.. _snpEff: http://snpeff.sourceforge.net/
.. _Ensembl variant effect predictor (VEP): http://www.ensembl.org/info/docs/tools/vep/index.html
.. _dbNSFP: https://sites.google.com/site/jpopgen/dbNSFP
.. _Heng Li's variant artifacts paper: http://arxiv.org/abs/1404.0929

.. _config-cancer:

Somatic variant calling
=======================

- ``min_allele_fraction`` Minimum allele fraction to detect variants in
  heterogeneous tumor samples, set as the float or integer **percentage** to
  resolve (i.e. 10 = alleles in 10% of the sample). Defaults to 10. Specify this
  in the tumor sample of a tumor/normal pair. It is percentage, not ratio,
  it is divided /100.0 when calling vardict!

- ``use_lowfreq_filter: false``. When set, forces vardict to report variants
  with low allelec frequency, useful to call variants in panels with high coverage
  (>1000x). The default (option is not set to false in the config) is to use
  low frequency filter, i.e. variants could be underreported (variant VAF is above
  min_allele_fraction but rejected by the filter).

.. _config-variant-annotation:

Variant annotation
==================

- ``effects`` Method used to calculate expected variant effects; defaults to
  `snpEff`_. `Ensembl variant effect predictor (VEP)`_ is also available
  when downloaded using :ref:`datatarget-install`. [snpeff, vep, false]
- ``effects_transcripts`` Define the transcripts to use for effect prediction
  annotation. Options ``all``: Standard Ensembl transcript list (the default);
  ``canonical``: Report single canonical transcripts (``-canon`` in snpEff,
  ``-pick`` in VEP); ``canonical_cancer`` Canonical transcripts with hand
  curated changes for more common cancer transcripts (effects snpEff only).
- ``vcfanno`` Configuration files for `vcfanno
  <https://github.com/brentp/vcfanno>`_, allowing the application of additional
  annotations to variant calls. By default, bcbio will try and apply:

   - ``gemini`` -- External population level annotations from `GEMINI
     <http://gemini.readthedocs.io/en/latest/>`_. This is only run for human
     samples with gemini data installed (:ref:`datatarget-install`).
   - ``somatic`` -- Somatic annotations from COSMIC, ClinVar and friends. COSMIC
     need a custom installation within bcbio (:ref:`datatarget-install`). Only
     added for tumor or tumor/normal somatic calling.
   - ``rnaedit`` -- RNA editing sites for RNA-seq variant calling runs.

  bcbio installs pre-prepared configuration files in
  ``genomes/build/config/vcfanno`` or you can specify the full path to a
  ``/path/your/anns.conf`` and optionally an equivalently
  named ``/path/your/anns.lua`` file. This value can be a list for multiple
  inputs.

.. _sv-config:

Structural variant calling
==========================

- ``svcaller`` -- List of structural variant callers to use. [lumpy, manta,
  cnvkit, gatk-cnv, seq2c, purecn, titancna, delly, battenberg]. LUMPY and Manta require paired end reads.
  cnvkit and gatk-cnv should not be used on the same sample due to
  incompatible normalization approaches, please pick one or the other for CNV calling.
- ``svprioritize`` --  Produce a tab separated summary file of structural
  variants in regions of interest. This complements the full VCF files of
  structural variant calls to highlight changes in known genes. See the `paper
  on cancer genome prioritization <https://peerj.com/articles/3166/>`_ for the
  full details. This can be
  either the path to a BED file (with ``chrom start end gene_name``, see
  :ref:`input-file-preparation`) or the name
  of one of the pre-installed prioritization files:

     - ``cancer/civic`` (hg19, GRCh37, hg38) -- Known cancer associated genes from
       `CIViC <https://civic.genome.wustl.edu>`_.
     - ``cancer/az300`` (hg19, GRCh37, hg38) -- 300 cancer associated genes
       contributed by `AstraZeneca oncology <https://www.astrazeneca.com/our-focus-areas/oncology.html>`_.
     - ``cancer/az-cancer-panel`` (hg19, GRCh37, hg38) -- A text file of genes in the
       AstraZeneca cancer panel. This is only usable for ``svprioritize`` which
       can take a list of gene names instead of a BED file.
     - ``actionable/ACMG56`` -- Medically actionable genes from the `The American College
       of Medical Genetics and Genomics <http://iobio.io/2016/03/29/acmg56/>`_
     - ``coding/ccds`` (hg38) -- `Consensus CDS (CCDS)
       <https://www.ncbi.nlm.nih.gov/projects/CCDS/CcdsBrowse.cgi>`_
       regions with 2bps added to internal introns to capture canonical splice
       acceptor/donor sites, and multiple transcripts from a single gene merged
       into a single all inclusive gene entry.
- ``fusion_mode`` Enable fusion detection in RNA-seq when using STAR (recommended)
  or Tophat (not recommended) as the aligner. OncoFuse is used to summarise the fusions
  but currently only supports ``hg19`` and ``GRCh37``. For explant samples
  ``disambiguate`` enables disambiguation of ``STAR`` output [false, true]. This
  option is deprecated in favor of ``fusion_caller``.
- ``fusion_caller`` Specify a standalone fusion caller for fusion mode. Supports
  ``oncofuse`` for STAR/tophat runs, ``pizzly`` and ``ericscript`` for all runs.
  If a standalone caller is specified (i.e. ``pizzly`` or ``ericscript`` ),
  fusion detection will not be performed with aligner. ``oncofuse`` only
  supports human genome builds GRCh37 and hg19. ``ericscript`` supports human
  genome builds GRCh37, hg19 and hg38 after installing the associated fusion
  databases (:ref:`datatarget-install`).
- ``known_fusions`` A TAB-delimited file of the format ``gene1<tab>gene2``, where ``gene1`` and
  ``gene2`` are identifiers of genes specified under ``gene_name`` in the attributes part of the
  GTF file.

HLA typing
==========
- ``hlacaller`` -- Perform identification of highly polymorphic HLAs with human
  build 38 (hg38). The recommended option is ``optitype``, using the `OptiType
  <https://github.com/FRED-2/OptiType>`_ caller. Also supports using the `bwa
  HLA typing implementation
  <https://github.com/lh3/bwa/blob/master/README-alt.md#hla-typing>`_ with ``bwakit``

Validation
===========

bcbio pre-installs standard truth sets for performing validation,
and also allows use of custom local files for assessing reliability of your
runs:

-  ``validate`` A VCF file of expected variant calls to perform
   validation and grading of small variants (SNPs and indels) from the pipeline.
   This provides a mechanism to ensure consistency of calls against
   a known set of variants, supporting comparisons to genotyping
   array data or reference materials.
- ``validate_regions`` A BED file of regions to evaluate small variant calls in. This
  defines specific regions covered by the ``validate`` VCF  file.
- ``svvalidate`` -- Dictionary of call types and pointer to BED file of known
  regions. For example: ``DEL: known_deletions.bed`` does deletion based
  validation of outputs against the BED file.

Each option can be either the path to a local file, or a partial path to a file
in the pre-installed truth sets. For instance, to validate an NA12878 run
against the `Genome in a Bottle <https://github.com/genome-in-a-bottle>`_ truth set::

    validate: giab-NA12878/truth_small_variants.vcf.gz
    validate_regions: giab-NA12878/truth_regions.bed
    svvalidate:
      DEL: giab-NA12878/truth_DEL.bed

follow the same naming schemes for small variants, regions and
different structural variant types. bcbio has the following validation materials
for germline validations:

- ``giab-NA12878`` --  `Genome in a Bottle
  <https://github.com/genome-in-a-bottle>`_ for NA12878, a Caucasian sample.
  Truth sets: small_variants, regions, DEL; Builds: GRCh37, hg19, hg38
- ``giab-NA24385`` --  `Genome in a Bottle
  <https://github.com/genome-in-a-bottle>`_ for NA24385, an Ashkenazic Jewish
  sample.
  Truth sets: small_variants, regions; Builds: GRCh37, hg19, hg38
- ``giab-NA24631`` --  `Genome in a Bottle
  <https://github.com/genome-in-a-bottle>`_ for NA24631, a Chinese sample.
  Truth sets: small_variants, regions; Builds: GRCh37, hg19, hg38
- ``giab-NA12878-crossmap`` --  `Genome in a Bottle
  <https://github.com/genome-in-a-bottle>`_ for NA12878 converted to hg38 with CrossMap. Truth sets: small_variants,
  regions, DEL; Builds: hg38
- ``giab-NA12878-remap`` --  `Genome in a Bottle
  <https://github.com/genome-in-a-bottle>`_ for NA12878 converted to hg38 with Remap. Truth sets: small_variants,
  regions, DEL; Builds: hg38
- ``platinum-genome-NA12878`` -- `Illumina Platinum Genome
  <http://www.illumina.com/platinumgenomes/>`_ for NA12878. Truth sets:
  small_variants, regions; Builds: hg19, hg38

and for cancer validations:

- ``giab-NA12878-NA24385-somatic`` -- A
  `sequenced NA12878/NA24385 mixture <ftp://ftp-trace.ncbi.nlm.nih.gov/giab/ftp/use_cases/mixtures/UMCUTRECHT_NA12878_NA24385_mixture_10052016/>`_
  providing a somatic-like truth set for detecting low frequency events. Build:
  Truth sets: small_variants, regions. Builds: GRCh37, hg38
- ``dream-syn3`` -- Synthetic dataset 3 from the `ICGC-TCGA DREAM mutation
  calling challenge <https://www.synapse.org/#!Synapse:syn312572/wiki/62018>`_.
  Truth sets: small_variants, regions, DEL, DUP, INV, INS. Builds: GRCh37.
- ``dream-syn4`` -- Synthetic dataset 4 from the `ICGC-TCGA DREAM mutation
  calling challenge <https://www.synapse.org/#!Synapse:syn312572/wiki/62018>`_.
  Truth sets: small_variants, regions, DEL, DUP, INV. Builds: GRCh37.
- ``dream-syn3-crossmap`` -- Synthetic dataset 3 from the `ICGC-TCGA DREAM mutation
  calling challenge <https://www.synapse.org/#!Synapse:syn312572/wiki/62018>`_
  converted to human build 38 coordinates with CrossMap.
  Truth sets: small_variants, regions, DEL, DUP, INV, INS. Builds: hg38.
- ``dream-syn4-crossmap`` -- Synthetic dataset 4 from the `ICGC-TCGA DREAM mutation
  calling challenge <https://www.synapse.org/#!Synapse:syn312572/wiki/62018>`_
  converted to human build 38 coordinates with CrossMap.
  Truth sets: small_variants, regions, DEL, DUP, INV. Builds: hg38.

For more information on the hg38 truth set preparation see the work on `validation on build
38 and conversion of human build 37 truth sets to build 38
<http://bcb.io/2015/09/17/hg38-validation/>`_. The `installation recipes
<https://github.com/chapmanb/cloudbiolinux/tree/master/ggd-recipes>`_ contain
provenance details about the origins of the installed files.

UMIs
====
Unique molecular identifiers (UMIs) are short random barcodes used to tag
individual molecules and avoid amplification biased. Both
single cell RNA-seq and variant calling support UMIs. For variant calling,
`fgbio <https://github.com/fulcrumgenomics/fgbio>`_ collapses sequencing
duplicates for each UMI into a single consensus read prior to running
re-alignment and variant calling. This requires ``mark_duplicates: true`` (the
default) since it uses position based duplicates and UMI tags for collapsing
duplicate reads into consensus sequences.

To help with preparing fastq files with UMIs bcbio provides a script
``bcbio_fastq_umi_prep.py``. This handles two kinds of UMI barcodes:

- Separate UMIs: it converts reads output by an Illumina as 3
  files (read 1, read 2, and UMIs).

- Duplex barcodes with tags incorporated at the 5' end of read 1 and read 2

In both cases, these get converted into paired reads with UMIs in the fastq
names, allowing specification of ``umi_type: fastq_name`` in your bcbio YAML
configuration. The script runs on a single set of files or autopairs an entire
directory of fastq files. To convert a directory with separate UMI files::

   bcbio_fastq_umi_prep.py autopair -c <cores_to_use> <list> <of> <fastq> <files>

To convert duplex barcodes present on the ends of read 1 and read 2::

   bcbio_fastq_umi_prep.py autopair -c <cores_to_use> --tag1 5 --tag2 5 <list> <of> <fastq> <files>

If you want to prepare your FASTQ files for use with the ``umi_type: fastq_name`` option and they
don't follow the two barcode schemes listed you can pre-transform the FASTQ files yourself by
putting ``:UMI_yourumisequence`` in the read name. Here is an example::

  @A00574:89:HCLMTDRXX:1:2101:1425:1016:UMI_CGAACGTGTACACG 2:N:0:CTGAAGCT+GGCTCTGA
  GTGATATAATTTATTTTCTTAAAATAGCCATGCTGGCTGGAGCCACAGCAGTTTACTCCCAGTTCATTACTCAGCTAACAGACGAAAACCAGT
  +
  FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF

For more complex UMI schemes please open up an issue and we can help you write a transformation to
prepare your files. We use https://github.com/vals/umis to do these more complex transformations.

Configuration options for UMIs:

- ``umi_type`` The UMI/cellular barcode scheme used for your data. For single
  cell RNA sequencing, supports [harvard-indrop, harvard-indrop-v2, 10x_v2, icell8, surecell].
  For variant analysis with UMI based consensus calling, supports either
  ``fastq_name`` with UMIs in read names or the path to a fastq file with
  UMIs for each aligned read.

- ``correct_umis: [path/to/whitelist_umi.txt]``. For a restricted set of UMIs specify a
  text file (one UMI per line). UMIs will be corrected with
  http://fulcrumgenomics.github.io/fgbio/tools/latest/CorrectUmis.html


You can adjust the `fgbio default options
<https://github.com/bcbio/bcbio-nextgen/blob/8a76c9e546cb79621707082fd763bd643e0e9652/bcbio/ngsalign/postalign.py#L208>`_
by adjusting :ref:`config-resources`. The most common change is modifying the
minimum number of reads as input to consensus sequences. This default to 1 to
avoid losing reads but you can set to larger values for high depth panels::

     resources:
       fgbio:
         options: [--min-reads, 2]


RNA sequencing
==============

- ``transcript_assembler`` If set, will assemble novel genes and transcripts and
  merge the results into the known annotation. Can have multiple values set in a
  list. Supports ['cufflinks', 'stringtie'].
- ``transcriptome_align`` If set to True, will also align reads to just the
  transcriptome, for use with EBSeq and others.
- ``expression_caller`` A list of optional expression callers to turn on.
  Supports ['cufflinks', 'express', 'stringtie', 'sailfish', 'dexseq', 'kallisto']. Salmon
  and count based expression estimation are run by default.
- ``fusion_caller`` A list of optional fusion callers to turn on. Supports
  [oncofuse, pizzly].
-  ``variantcaller`` Variant calling algorithm to call variants on RNA-seq data. Supports [gatk-haplotype] or [vardict].
- ``spikein_fasta`` A FASTA file of spike in sequences to quantitate.
- ``quantify_genome_alignments`` If set to True, run Salmon quantification using the genome
  alignments from STAR, when available. If STAR alignments are not available, use Salmon's
  SA mode with decoys.
- ``bcbiornaseq`` A dictionary of key-value pairs to be passed as options to bcbioRNAseq. Currently supports `organism` as a key and takes the latin name of the genome used (`mus musculus`, `homo sapiens`, etc) and `interesting_groups` which will be used to color quality control plots.::

    bcbiornaseq:
      organism: homo sapiens
      interesting_groups: [treatment, genotype, etc, etc]

You will need to also turn on ``bcbiornaseq`` by turning it on via ``tools_on: [bcbiornaseq]``.

Fast RNA-seq
============
- ``transcriptome_fasta`` An optional FASTA file of transcriptome sequences to
  quantitate rather than using bcbio installed transcriptome sequences.

Single-cell RNA sequencing
==========================

- ``minimum_barcode_depth`` Cellular barcodes with less than this many reads
  assigned to them are discarded (default 10,000).
- ``cellular_barcodes`` A single file or a list of one or two files which have
  valid cellular barcodes. Provide one file if there is only one barcode and
  two files if the barcodes are split. If no file is provided, all cellular
  barcodes passing the ``minimum_barcode_depth`` filter are kept.
- ``transcriptome_fasta`` An optional FASTA file of transcriptome sequences to
  quantitate rather than the bcbio installed version.
- ``transcriptome_gtf`` An optional GTF file of the transcriptome to quantitate,
  rather than the bcbio installed version. This is recommended for single-cell
  RNA-sequencing experiments.
- ``singlecell_quantifier`` Quantifier to use for single-cell RNA-sequencing.
  Supports ``rapmap`` or ``kallisto``.
- ``cellular_barcode_correction`` Number of errors to correct in identified
  cellular barcodes. Requires a set of known barcodes to be passed with the
  ``cellular_barcodes`` option. Defaults to 1. Set to 0 to turn off
  error correction.
- ``sample_barcodes`` A text file with one barcode per line of expected sample
  barcodes. If the file contains sample name for each barcode, this will be used to
  create a ``tagcounts.mtx.metadata`` that match each cell with the sample name
  associated with the barcode. The actual barcodes may be reverse complements of the
  sequences provided with the samples. It worth to check before running bcbio.
  For inDrops procol samples barcodes are in the fastq file for read3.
  This is an example of the ``sample_barcodes`` file::

    AATTCCGG,sample1
    CCTTGGAA,sample2

- ``demultiplexed`` If set to True, each file will be treated as a cell or well and not
  a collection of cells. Use this if your data has already been broken up into cells or
  wells.

smallRNA sequencing
===================

- ``adapters`` The 3' end adapter that needs to be remove. For NextFlex protocol you can add
  ``adapters: ["4N", "$3PRIME_ADAPTER"]``. For any other options you can use
  resources: ``atropos:options:["-u 4", "-u -4"]``.
- ``species`` 3 letters code to indicate the species in mirbase classification (i.e. hsa for human).
- ``aligner`` Currently STAR is the only one tested although bowtie can be used as well.
- ``expression_caller`` A list of expression callers to turn on: trna, seqcluster, mirdeep2, mirge (read :ref:`smallRNA-seq` to learn how to set up bcbio to run mirge)
- ``transcriptome_gtf`` An optional GTF file of the transcriptome to for seqcluster.
- ``spikein_fasta`` A FASTA file of spike in sequences to quantitate.
- ``umi_type: 'qiagen_smallRNA_umi'`` Support of Qiagen UMI small RNAseq protocol.

ChIP/ATAC sequencing
===============

- ``peakcaller`` bcbio only accepts ``[macs2]``
- ``aligner`` Currently ``bowtie2`` is the only one tested. ``bwa`` is also available.
- The ``phenotype`` and ``batch`` tags need to be set under ``metadata`` in the config YAML file. The ``phenotype`` tag will specify the chip (``phenotype: chip``) and input samples (``phenotype: input``). The ``batch`` tag will specify the input-chip pairs of samples for example, ``batch: pair1``. Same input can be used for different chip samples giving a list of distinct values: ``batch: [sample1, sample2]``.
- ``chip_method``: currently supporting standard CHIP-seq (TF or broad regions using `chip`) or ATAC-seq (`atac`). Parameters will change depending on the option to get the best possible results. Only macs2 supported for now.
- ``antibody``: automatically sets peakcalling options tailored for the specific anitbody. Supports `h3f3a`, `h3k27me3`, `h3k36me3`, `h3k4me1`, `h3k79me2`, `h3k9me3`, `h3k9me1`, `h3k9me2`, `h4k20me1`, `h2afz`, `h3ac`, `h3k27ac`, `h3k4me2`, `h3k4me3`, `h3k9ac`, `h3k9me3`.
- ``keep_duplicates``: do not remove duplicates before peak calling. Defaults to `False`.
- ``keep_multimapped``: do not remove multimappers before peak calling. Defaults to `False`.

You can pass different parameters for ``macs2`` adding to :ref:`config-resources`::


        resources:
          macs2:
            options: ["--broad"]

.. _docs-config-qc:

Methylation
===========
- ``aligner`` supports ``bismark``


Quality control
===============

- ``qc`` Allows you to specifically assign quality control modules to run.
  Generally you want to leave this unset and allow bcbio to run the correct QC
  metrics for your experiment, or remove specific QC steps you don't want using
  ``tools_off`` (:ref:`config-changing-defaults`). However, this can allow
  turning off most of the QC by specifying a single quick running step like
  ``picard``. Available tools are ``fastqc``, ``samtools``, ``coverage``,
  ``picard``, ``contamination`` (VerifyBamID), ``peddy``, ``viral``, ``damage``,
  ``umi``, ``small-rna``, ``atropos``, ``chipqc``.
- ``mixup_check`` Detect potential sample mixups. Currently supports
  `qSignature <https://sourceforge.net/p/adamajava/wiki/qSignature/>`_.
  ``qsignature_full`` runs a larger analysis while ``qsignature`` runs a smaller
  subset on chromosome 22.  [False, qsignature, qsignature_full]
- ``kraken`` Turn on kraken algorithm to detect possible contamination. You can
  add ``kraken: minikraken`` and it will use a minimal database to detect possible
  `contaminants`_. As well, you can point to a `custom database`_ directory and
  kraken will use it. You will find the results in the `qc` directory. You need
  to use `--datatarget kraken` during installation to make the minikraken
  database available.
- ``preseq`` Accepts ``lc_extrap`` or ``c_curve``, and runs Preseq <http://smithlabresearch.org/software/preseq>`_,
  a tool that predicts the yield for future experiments. By default, it runs 300
  steps of estimation using the segment length of 100000. The default extrapolation
  limit for ``lc_extrap`` is 3x of the reads number. You can override the parameters
  ``seg_len``, ``steps``, ``extrap_fraction`` using the :ref:`config-resources`: section::

        resources:
          preseq:
            extrap_fraction: 5
            steps: 500
            seg_len: 5000

  And you can also set ``extrap`` and ``step`` parameters directly, as well as provide any
  other command line option via ``options``::

        resources:
          preseq:
            extrap: 10000000
            step: 30000
            options: ["-D"]
- bcbio uses `MultiQC <http://multiqc.info/>`_ to combine QC output for all
  samples into a single report file. If you need to tweak configuration settings
  from bcbio defaults, you can use :ref:`config-resources`. For instance to
  display read counts with full numbers instead of the default millions::

       resources:
         multiqc:
           options: ["--cl_config", "'read_count_multiplier: 1'"]

  or as thousands::

       resources:
         multiqc:
           options: ["--cl_config", "'{read_count_multiplier: 0.001, read_count_prefix: K}'"]

.. _contaminants: https://ccb.jhu.edu/software/kraken/
.. _custom database: https://github.com/DerrickWood/kraken

Post-processing
===============

- ``archive`` Specify targets for long term archival. ``cram`` removes fastq
  names and does 8-bin compression of BAM files into `CRAM format`_.
  ``cram-lossless`` generates CRAM files without changes to quality scores or
  fastq name. Default: [] -- no archiving. Lossy cram has some issues,
  lossless cram provides pretty good compression relative to BAM, and many
  machines output binned values now, so ``cram-lossless`` is what we
  recommend you use.

.. _CRAM format: http://www.ebi.ac.uk/ena/about/cram_toolkit

.. _config-changing-defaults:

Changing bcbio defaults
=======================

bcbio provides some hints to change default behavior be either turning specific
defaults on or off, with ``tools_on`` and ``tools_off``. Both can be
lists with multiple options:

- ``tools_off`` Specify third party tools to skip as part of analysis
  pipeline. Enables turning off specific components of pipelines if not
  needed:

  - ``gatk4`` Use older GATK versions (3.x) for GATK commands like BQSR,
    HaplotypeCaller and VQSR. By default bcbio includes GATK4 and uses it.
  - ``vqsr`` turns off variant quality score recalibration for all samples.
  - ``bwa-mem`` forces use of original ``bwa aln`` alignment. Without this, we
    use bwa mem with 70bp or longer reads.
  - ``lumpy-genotype`` skip genotyping for Lumpy samples, which can be slow in
    the case of many structural variants.
  - ``seqcluster`` turns off use of seqcluster tool in srnaseq pipeline.
  - ``tumoronly-prioritization`` turns off attempted removal of germline
    variants from tumor only calls using external population data sources like
    ExAC and 1000 genomes.
  - ``vardict_somatic_filter`` disables running a post calling filter for
    VarDict to remove variants found in normal samples. Without
    ``vardict_somatic_filter`` in paired analyses no soft filtering of germline
    variants is performed but all high quality variants pass.
  - ``upload_alignment`` turns off final upload of large alignment files.
  - ``pbgzip`` turns off use of bgzip with multiple threads.
  - For quality control, you can turn off any specific tool by adding to ``tools_off``.
    For example, ``fastqc`` turns off quality control FastQC usage.
    and ``coverage_qc`` turns off calculation of coverage statistics with
    samtools-stats and picard. See the :ref:`docs-config-qc` docs for
    details on tools.

- ``tools_on`` Specify functionality to enable that is off by default:

  - ``bcbiornaseq`` loads a bcbioRNASeq object for use with `bcbioRNASeq <https://github.com/hbc/bcbioRNASeq>`_.
  - ``bnd-genotype`` enables genotyping of breakends in Lumpy calls, which
    improves accuracy but can be slow.
  - ``bwa-mem`` forces use of bwa mem even for samples with less than 70bp
  reads.
  - ``coverage_perbase`` calculates per-base coverage depth for analyzed variant
    regions.
  - ``damage_filter`` annotates low frequency somatic calls in INFO/DKFZBias for
  DNA damage artifacts using `DKFZBiasFilter <https://github.com/eilslabs/DKFZBiasFilter>`_.
  - ``gemini`` Create a `GEMINI database <https://github.com/arq5x/gemini>`_ of variants for
    downstream query using the new vcfanno and vcf2db approach.
  - ``gemini_allvariants`` enables all variants to go into GEMINI, not only
    those that pass filters.
  - ``gemini_orig`` Create a `GEMINI database <https://github.com/arq5x/gemini>`_
    of variants using the older GEMINI loader. Only works for GRCh37 and hg19.
  - ``gvcf`` forces gVCF output for callers that support it (GATK
    HaplotypeCaller, FreeBayes, Platypus). For joint calling using a population of samples,
    please use `jointcaller` (:ref:`population-calling`).
  - ``lumpy_usecnv`` uses input calls from CNVkit as prior evidence to Lumpy
    calling.
  - ``noalt_calling`` call variants only for chr1,,22,X,Y,MT.
  - ``qualimap`` runs `Qualimap <http://qualimap.bioinfo.cipf.es/>`_ (qualimap
    uses downsampled files and numbers here are an estimation of 1e7 reads.).
  - ``qualimap_full`` runs Qualimap with full bam files but it may be slow.
  - ``svplots`` adds additional coverage and summary plots for CNVkit and detected
    ensemble variants.
  - ``tumoronly_germline_filter`` applies a ``LowPriority`` filter to tumor-only calls
    that match population germline databases. The default is to just apply a tag ``EPR``
    (external prioritization) that flags variants present in external databases.
    Anything missing a ``pass`` here is a likely germline.
  - ``vcf2db_expand`` decompresses and expands the genotype columns in the
    vcfanno prepared GEMINI databases, enabling standard SQL queries on
    genotypes and depths.
  - ``vqsr`` makes GATK try quality score recalibration for variant filtration,
    even for smaller sample sizes.
  - ``vep_splicesite_annotations`` enables the use of the MaxEntScan and
    SpliceRegion plugin for VEP. Both optional plugins add extra splice site
    annotations.



parallelization
===============

- ``nomap_split_size`` Unmapped base pair regions required to split
  analysis into blocks. Creates islands of mapped reads surrounded by
  unmapped (or N) regions, allowing each mapped region to run in
  parallel. (default: 250)

- ``nomap_split_targets`` Number of target intervals to attempt to
  split processing into. This picks unmapped regions evenly spaced
  across the genome to process concurrently. Limiting targets prevents
  a large number of small targets. (default: 200 for standard runs,
  20 for CWL runs)

Ensemble variant calling
========================

In addition to single method variant calling, we support calling with
multiple calling methods and consolidating into a final Ensemble
callset.

The recommended method to do this uses a simple majority rule ensemble
classifier that builds a final callset based on the intersection of calls. It
selects variants represented in at least a specified number of callers::

    variantcaller: [mutect2, varscan, freebayes, vardict]
    ensemble:
      numpass: 2
      use_filtered: false

This example selects variants present in 2 out of the 4 callers and does not use
filtered calls (the default behavior). Because of the difficulties of producing
a unified FORMAT/genotype field across callers, the ensemble outputs contains a
mix of outputs from the different callers. It picks a representative sample in
the order of specified caller, so in the example above would have a MuTect2 call
if present, otherwise a VarScan call if present, otherwise a FreeBayes call.
This may require custom normalization scripts during post-processing when using
these calls. `bcbio.variation.recall`_ implements this approach, which handles
speed and file sorting limitations in the `bcbio.variation`_ approach.

This older approach uses the `bcbio.variation`_
toolkit to perform the consolidation. An example configuration in the
``algorithm`` section is::

    variantcaller: [gatk, freebayes, samtools, gatk-haplotype, varscan]
    ensemble:
      format-filters: [DP < 4]
      classifier-params:
        type: svm
      classifiers:
        balance: [AD, FS, Entropy]
        calling: [ReadPosEndDist, PL, PLratio, Entropy, NBQ]
      trusted-pct: 0.65

The ``ensemble`` set of parameters configure how to combine calls from
the multiple methods:

- ``format-filters`` A set of filters to apply to variants before
  combining. The example removes all calls with a depth of less than
  4.
- ``classifier-params`` Parameters to configure the machine learning
  approaches used to consolidate calls. The example defines an SVM
  classifier.
- ``classifiers`` Groups of classifiers to use for training and
  evaluating during machine learning. The example defines two set of
  criteria for distinguishing reads with allele balance issues and
  those with low calling support.
- ``trusted-pct`` Define threshold of variants to include in final
  callset. In the example, variants called by more than 65% of the
  approaches (4 or more callers) pass without being requiring SVM
  filtering.

.. _config-resources:

Resources
~~~~~~~~~

The ``resources`` section allows customization of locations of programs
and memory and compute resources to devote to them::

    resources:
      bwa:
        cores: 12
        cmd: /an/alternative/path/to/bwa
      samtools:
        cores: 16
        memory: 2G
      gatk:
        jvm_opts: ["-Xms2g", "-Xmx4g"]
      mutect2_filter:
        options: ["--max-events-in-region", "2"]

- ``cmd`` Location of an executable. By default, we assume executables
  are on the path.
- ``cores`` Cores to use for multi-proccessor enabled software. This is how
  many cores will be allocated per job. For example if you are running
  10 samples and passed -n 40 to bcbio-nextgen and the step you are running
  has cores: 8 set, a maximum of five samples will run in parallel, each using
  8 cores.
- ``jvm_opts`` Specific memory usage options for Java software. For
  memory usage on programs like GATK, specify the maximum usage per
  core. On multicore machines, that's machine-memory divided by cores.
  This avoids memory errors when running multiple jobs simultaneously,
  while the framework will adjust memory up when running multicore
  jobs.
- ``memory`` Specify the memory per core used by a process. For programs
  where memory control is available, like ``samtools sort``,
  this limits memory usage. For other programs this is an estimate of
  usage, used by :ref:`memory-management` to avoid over-scheduling
  memory. Always specify this as the memory usage for a single core,
  and the pipeline handles scaling this when a process uses multiple
  cores.
- ``keyfile`` Specify the location of a program specific key file or license
  server, obtained from a third party software tool. Supports licenses for
  `novoalign <http://www.novocraft.com/products/novoalign/>`_ and `Sentieon
  <http://www.sentieon.com/products.html>`_. For more complex Sentieon setups
  this can also be a dictionary of environmental variables::

      resources:
        sentieon:
          keyfile:
            SENTIEON_LICENSE_SERVER: 100.100.100.100:8888
            SENTIEON_AUTH_MECH: XXX
            SENTIEON_AUTH_DATA: signature
- ``options`` Adjust specific command line options for a program. This can be hard
  to support for many tools due to conflicts with other existing options but is
  available for some tools:
    - ``mutect2``, ``mutect2_filter``: Adjust for Mutect2 calls and filtering.

Temporary directory
===================

You also use the resource section to specify system specific parameters like
global temporary directories::

    resources:
      tmp:
        dir: /scratch

This is useful on cluster systems with large attached local storage, where you
can avoid some shared filesystem IO by writing temporary files to the local
disk. When setting this keep in mind that the global temporary disk must have
enough space to handle intermediates. The space differs between steps but
generally you'd need to have 2 times the largest input file per sample and
account for samples running simultaneously on multiple core machines.

To handle clusters that specify local scratch space with an environmental
variable, bcbio will resolve environmental variables like::


    resources:
      tmp:
        dir: $YOUR_SCRATCH_LOCATION

.. _sample-resources:

Sample or run specific resources
================================

To override any of the global resource settings in a sample specific manner, you
write a resource section within your sample YAML configuration. For example, to
create a sample specific temporary directory and pass a command line option to
novoalign, write a sample resource specification like::

    - description: Example
      analysis: variant2
      resources:
        novoalign:
          options: ["-o", "FullNW", "--rOQ"]
        tmp:
          dir: tmp/sampletmpdir

To adjust resources for an entire run, you can add this resources specification
at the top level of your sample YAML::

     details:
       - description: Example
     resources:
       default:
         cores: 16

.. _bcbio.variation: https://github.com/chapmanb/bcbio.variation
.. _bcbio.variation.recall: https://github.com/chapmanb/bcbio.variation.recall
.. _CloudBioLinux: https://github.com/chapmanb/cloudbiolinux
.. _YAML format: https://en.wikipedia.org/wiki/YAML#Examples
.. _GATK: http://www.broadinstitute.org/gatk/
.. _system: https://github.com/bcbio/bcbio-nextgen/blob/master/config/bcbio_system.yaml
.. _sample: https://github.com/bcbio/bcbio-nextgen/blob/master/config/bcbio_sample.yaml
.. _Galaxy API: http://wiki.galaxyproject.org/Learn/API
.. _Amazon S3: http://aws.amazon.com/s3/
.. _Galaxy Admin: http://wiki.galaxyproject.org/Admin/DataLibraries/LibrarySecurity

Logging directory
=================

By default, bcbio writes the :ref:`logging-output` directory to ``log`` in the
main directory of the run. You can configure this to a different location in
your ``bcbio-system.yaml`` with::

    log_dir: /path/to/logs

.. _input-file-preparation:

Input file preparation
~~~~~~~~~~~~~~~~~~~~~~

Input files for supplementing analysis, like ``variant_regions`` need to match
the specified reference genome. A common cause of confusion is the two
chromosome naming schemes for human genome build 37: UCSC-style in hg19 (chr1,
chr2) and Ensembl/NCBI style in GRCh37 (1, 2). To help avoid some of this
confusion, in build 38 we only support the commonly agreed on chr1, chr2 style.

It's important to ensure that the chromosome naming in your input files match
those in the reference genome selected. bcbio will try to detect this and
provide helpful errors if you miss it.

To convert chromosome names, you can use `Devon Ryan's collection of chromosome
mappings <https://github.com/dpryan79/ChromosomeMappings>`_ as an input to sed.
For instance, to convert hg19 chr-style coordinates to GRCh37::

      wget --no-check-certificate -qO- http://raw.githubusercontent.com/dpryan79/ChromosomeMappings/master/GRCh37_UCSC2ensembl.txt \
         | awk '{if($1!=$2) print "s/^"$1"/"$2"/g"}' > remap.sed
      sed -f remap.sed original.bed > final.bed

Genome configuration files
~~~~~~~~~~~~~~~~~~~~~~~~~~
Each genome build has an associated ``buildname-resources.yaml``
configuration file which contains organism specific naming and
resource files. bcbio-nextgen expects a resource file present next to
the genome FASTA file. `Example genome configuration files`_ are available, and
automatically installed for natively supported genomes. Create these
by hand to support additional organisms or builds.

The major sections of the file are:

- ``aliases`` -- Names for third-party programs used as part of the
  analysis, since naming expectations can differ between software
  programs.

- ``variation`` -- Supporting data files for variant analysis. For human
  analyses, the dbSNP and training files are from the `GATK resource bundle`_.
  These are inputs into the training models for
  recalibration. The automated `CloudBioLinux`_ data scripts will
  download and install these in the variation subdirectory relative to
  the genome files.

- ``rnaseq`` -- Supporting data files for RNA-seq analysis. The
  automated installer and updater handles retrieval and installation
  of these resources for supported genome builds.

- ``srnaseq`` -- Supporting data files for smallRNA-seq analysis. Same as in
  rnaseq, the automated installer and updater handle this for supported genome
  builds.


By default, we place the ``buildname-resources.yaml`` files next to
the genome FASTA files in the reference directory. For custom setups,
you specify an alternative directory in the ref:`config-resources`
section of your ``bcbio_system.yaml`` file::

  resources:
    genome:
      dir: /path/to/resources/files

.. _Example genome configuration files: https://github.com/bcbio/bcbio-nextgen/tree/master/config/genomes
.. _GATK resource bundle: http://www.broadinstitute.org/gatk/guide/article.php?id=1213

Reference genome files
~~~~~~~~~~~~~~~~~~~~~~

The pipeline requires access to reference genomes, including the raw
FASTA sequence and pre-built indexes for aligners. The automated installer
will install reference files and indexes for commonly used genomes (see the
:ref:`upgrade-install` documentation for command line options).

For human genomes, we recommend using build 38 (hg38). This is `fully supported
and validated <http://bcb.io/2015/09/17/hg38-validation/>`_ in bcbio, and
corrects a lot of issues in the previous build 37. We use the `1000 genomes
distribution
<ftp://ftp.1000genomes.ebi.ac.uk/vol1/ftp/technical/reference/GRCh38_reference_genome/>`_
which includes HLAs and decoy sequences. For human build 37, GRCh37 and hg19, we
use the 1000 genome references provided in the `GATK resource bundle`_. These
differ in chromosome naming: hg19 uses chr1, chr2, chr3 style contigs while
GRCh37 uses 1, 2, 3. They also differ `slightly in content
<https://gatkforums.broadinstitute.org/gatk/discussion/1810/whats-the-difference-between-b37-and-hg19-resources>`_:
GRCh37 has masked `Pseudoautosomal regions
<https://en.wikipedia.org/wiki/Pseudoautosomal_region>`_ on chromosome Y
allowing alignment to these regions on chromosome X.


You can use pre-existing data and reference indexes by pointing bcbio-nextgen at
these resources. We use the `Galaxy .loc files`_ approach to describing the
location of the sequence and index data, as described in
:ref:`data-requirements`. This does not require a Galaxy installation since the
installer sets up a minimal set of ``.loc`` files. It finds these by identifying
the root ``galaxy`` directory, in which it expects a ``tool-data`` sub-directory
with the ``.loc`` files. It can do this in two ways:

- Using the directory of your ``bcbio-system.yaml``. This is the
  default mechanism setup by the automated installer and requires no additional
  work.

- From the path specified by the ``galaxy_config`` option in your
  ``bcbio-system.yaml``. If you'd like to move your system YAML file,
  add the full path to your ``galaxy`` directory here. This is useful if you
  have a pre-existing Galaxy installation with reference data.

To manually make genomes available to bcbio-nextgen, edit the individual
``.loc`` files with locations to your reference and index genomes. You need to
edit ``sam_fa_indices.loc`` to point at the FASTA files and then any genome
indexes corresponding to aligners you'd like to use (for example:
``bwa_index.loc`` for bwa and ``bowtie2_indices.loc`` for bowtie2). The database
key names used (like ``GRCh37`` and ``mm10``) should match those used in the
``genome_build`` of your sample input configuration file.

.. _Galaxy .loc files: http://wiki.galaxyproject.org/Admin/NGS%20Local%20Setup

.. _config-custom:

Adding custom genomes
~~~~~~~~~~~~~~~~~~~~~~
``bcbio_setup_genome.py`` will help you to install a custom genome and apply all changes needed
to the configuration files. It needs the genome in FASTA format, and the annotation file
in GTF or GFF3 format. It can create index for all aligners used by bcbio. Moreover, it will create
the folder `rnaseq` to allow you run the RNAseq pipeline without further configuration. The ``--buildversion``
option will write that string to the ``version.txt`` file, to track from where and which version of
a gene build was used.

::

    bcbio_setup_genome.py -f genome.fa -g annotation.gtf -i bowtie2 star seq -n Celegans -b WBcel135 --buildversion WormBase_34

If you want to add smallRNA-seq data files, you will need to add the 3 letters code of mirbase
for your genome (i.e hsa for human) and the GTF file for the annotation of smallRNA data.
Here you can use the same file than the transcriptome if no other available.

::

    bcbio_setup_genome.py -f genome.fa -g annotation.gtf -i bowtie2 star seq -n Celegans -b WBcel135 --species cel --srna_gtf another_annotation.gtf --buildversion WormBase_34

To use that genome just need to configure your YAML files as::

    genome_build: WBcel135

Effects prediction
==================

To perform variant calling and predict effects in a custom genome you'd have to
manually download and link this into your installation. First find the snpEff
genome build::

    $ snpEff databases | grep Lactobacillus | grep pentosus
    Lactobacillus_pentosus_dsm_20314                                Lactobacillus_pentosus_dsm_20314                                              ENSEMBL_BFMPP_32_179            http://downloads.sourceforge.net/project/snpeff/databases/v4_3/snpEff_v4_3_ENSEMBL_BFMPP_32_179.zip
    Lactobacillus_pentosus_kca1                                     Lactobacillus_pentosus_kca1                                                   ENSEMBL_BFMPP_32_179            http://downloads.sourceforge.net/project/snpeff/databases/v4_3/snpEff_v4_3_ENSEMBL_BFMPP_32_179.zip

then download to the appropriate location::

    $ cd /path/to/bcbio/genomes/Lacto/Lactobacillus_pentosus
    $ mkdir snpEff
    $ cd snpEff
    $ wget http://downloads.sourceforge.net/project/snpeff/databases/v4_3/snpEff_v4_3_ENSEMBL_BFMPP_32_179.zip
    $ unzip snpEff_v4_3_ENSEMBL_BFMPP_32_179.zip
    $ find . -name "Lactobacillus_pentosus_dsm_20314"
     ./home/pcingola/snpEff/data/Lactobacillus_pentosus_dsm_20314
    $ mv ./home/pcingola/snpEff/data/Lactobacillus_pentosus_dsm_20314 .

finally add to your genome configuration file
(``seq/Lactobacillus_pentosus-resources.yaml``)::

    aliases:
      snpeff: Lactobacillus_pentosus_dsm_20314

For adding an organism not present in snpEff, please see this
`mailing list discussion <https://groups.google.com/d/msg/biovalidation/LPFBlwVBh5s/AMU7MVvQAwAJ>`_.
